mtnE [2018-09-06 18:42:13]

glutamine transaminase

locus: BSU13580

pI: 4.91

mw: 43.88 kDa

protein length: 398 aa

gene length: 1194 bp

function: methionine salvage

product: glutamine transaminase

essential: no

synonyms: ykrV

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]

Gene

Coordinates: 1,425,641 → 1,426,837

Phenotypes of a mutant

• reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]

The protein

Catalyzed reaction/ biological activity

• 2-ketomethylthiobutyrate + glutamine --→ 2-ketoglutaramate + methionine [Pubmed|24837359]

Protein family

• MtnE subfamily (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]
  description: [Pubmed|12022921]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

Biological materials

Mutant

• MGNA-B321 (ykrV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1320 NBRP B. subtilis, Japan]
• BKE13580 (Δ[gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCTCACCTTCTAA, downstream forward: _UP4_TAACGATGGGATAATTCAAA
• BKK13580 (Δ[gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCTCACCTTCTAA, downstream forward: _UP4_TAACGATGGGATAATTCAAA

References

• 12670965,15102328,12022921,24837359